Close Menu
5gantennas.org5gantennas.org
  • Home
  • 5G
    • 5G Technology
  • 6G
  • AI
  • Data
    • Global 5G
  • Internet
  • WIFI
  • 5G Antennas
  • Legacy

Subscribe to Updates

Subscribe to our newsletter and never miss our latest news

Subscribe my Newsletter for New Posts & tips Let's stay updated!

What's Hot

4 Best Wi-Fi Mesh Networking Systems in 2024

September 6, 2024

India is on the brink of a new revolution in telecommunications and can lead the world with 6G: Jyotiraditya Scindia

August 29, 2024

Speaker Pelosi slams California AI bill headed to Governor Newsom as ‘ignorant’

August 29, 2024
Facebook X (Twitter) Instagram
Facebook X (Twitter) Instagram
5gantennas.org5gantennas.org
  • Home
  • 5G
    1. 5G Technology
    2. View All

    Deutsche Telekom to operate 12,500 5G antennas over 3.6 GHz band

    August 28, 2024

    URCA Releases Draft “Roadmap” for 5G Rollout in the Bahamas – Eye Witness News

    August 23, 2024

    Smart Launches Smart ZTE Blade A75 5G » YugaTech

    August 22, 2024

    5G Drone Integration Denmark – DRONELIFE

    August 21, 2024

    Hughes praises successful private 5G demo for U.S. Navy

    August 29, 2024

    GSA survey reveals 5G FWA has become “mainstream”

    August 29, 2024

    China Mobile expands 5G Advanced, Chunghwa Telecom enters Europe

    August 29, 2024

    Ateme and ORS Boost 5G Broadcast Capacity with “World’s First Trial of IP-Based Statmux over 5G Broadcast” | TV Tech

    August 29, 2024
  • 6G

    India is on the brink of a new revolution in telecommunications and can lead the world with 6G: Jyotiraditya Scindia

    August 29, 2024

    Vodafonewatch Weekly: Rural 4G, Industrial 5G, 6G Patents | Weekly Briefing

    August 29, 2024

    Southeast Asia steps up efforts to build 6G standards

    August 29, 2024

    Energy efficiency as an inherent attribute of 6G networks

    August 29, 2024

    Finnish working group launches push for 6G technology

    August 28, 2024
  • AI

    Speaker Pelosi slams California AI bill headed to Governor Newsom as ‘ignorant’

    August 29, 2024

    Why Honeywell is betting big on Gen AI

    August 29, 2024

    Ethically questionable or creative genius? How artists are engaging with AI in their work | Art and Design

    August 29, 2024

    “Elon Musk and Trump” arrested for burglary in disturbing AI video

    August 29, 2024

    Nvidia CFO says ‘enterprise AI wave’ has begun and Fortune 100 companies are leading the way

    August 29, 2024
  • Data
    1. Global 5G
    2. View All

    Global 5G Enterprise Market is expected to be valued at USD 34.4 Billion by 2032

    August 12, 2024

    Counterpoint predicts 5G will dominate the smartphone market in early 2024

    August 5, 2024

    Qualcomm’s new chipsets will power affordable 5G smartphones

    July 31, 2024

    Best Super Fast Download Companies — TradingView

    July 31, 2024

    Crypto Markets Rise on Strong US Economic Data

    August 29, 2024

    Microsoft approves construction of third section of Mount Pleasant data center campus

    August 29, 2024

    China has invested $6.1 billion in state-run data center projects over two years, with the “East Data, West Computing” initiative aimed at capitalizing on the country’s untapped land.

    August 29, 2024

    What is the size of the clinical data analysis solutions market?

    August 29, 2024
  • Internet

    NATO believes Russia poses a threat to Western internet and GPS services

    August 29, 2024

    Mpeppe grows fast, building traction among Internet computer owners

    August 29, 2024

    Internet Computer Whale Buys Mpeppe (MPEPE) at 340x ROI

    August 29, 2024

    Long-term internet computer investor adds PEPE rival to holdings

    August 29, 2024

    Biden-Harris Administration Approves Initial Internet for All Proposals in Mississippi and South Dakota

    August 29, 2024
  • WIFI

    4 Best Wi-Fi Mesh Networking Systems in 2024

    September 6, 2024

    Best WiFi deal: Save $200 on the Starlink Standard Kit AX

    August 29, 2024

    Sonos Roam 2 review | Good Housekeeping UK

    August 29, 2024

    Popular WiFi extender that eliminates dead zones in your home costs just $12

    August 29, 2024

    North American WiFi 6 Mesh Router Market Size, Share, Forecast, [2030] – அக்னி செய்திகள்

    August 29, 2024
  • 5G Antennas

    Nokia and Claro bring 5G to Argentina

    August 27, 2024

    Nokia expands FWA portfolio with new 5G devices – SatNews

    July 25, 2024

    Deutsche Telekom to operate 12,150 5G antennas over 3.6 GHz band

    July 24, 2024

    Vodafone and Ericsson develop a compact 5G antenna in Germany

    July 12, 2024

    Vodafone and Ericsson unveil new small antennas to power Germany’s 5G network

    July 11, 2024
  • Legacy
5gantennas.org5gantennas.org
Home»Data»Searching for data in DNA using CRISPR
Data

Searching for data in DNA using CRISPR

5gantennas.orgBy 5gantennas.orgMarch 19, 2024No Comments6 Mins Read
Facebook Twitter Pinterest LinkedIn Tumblr Email
Share
Facebook Twitter LinkedIn Pinterest WhatsApp Email


This article has been reviewed in accordance with Science X’s editorial processes and policies. The editors have highlighted the following attributes while ensuring the authenticity of the content:

fact confirmed

trusted sources

proofread


A framework for DNA data storage systems with search capabilities and the general workflow of SEEKER. be The complete framework for a searchable DNA data storage system includes writing, searching, and reading data. b The oligo pool that stores text data is constructed in two parts: a reference strand and a data strand. The reference strand is typically composed of 100-200 oligos and can be used as a dictionary used to map the data strand to a binary code or pre-sequenced to determine the crRNA spacer sequence for the query of interest. can. For example, the keyword “courage” corresponds to the crRNA sequence “CTGTGCTAGCGTATGGCTCAT”. The data strands are selectively amplified according to the file ID and incubated with the Cas12a-crRNA ribonucleoprotein complex. If the amplified file contains many repetitions of the keyword “courage”, the fluorescence intensity will increase rapidly, producing a strong fluorescence signal within a short time. When fewer instances of the keyword “courage” appear in the file, the fluorescence enhancement is delayed and the endpoint fluorescence intensity becomes weaker. If the keyword “courage” is not found in the file, no fluorescence will be detected. After searching, files that generate a positive signal are recognized as containing the desired data and undergo next-generation sequencing to restore their full content. In this example, two occurrences of the keyword “courage” will generate a stronger signal, and a single occurrence of the keyword “he” will generate a weaker signal. Illustration created by BioRender.com. credit: nature communications (2024). DOI: 10.1038/s41467-024-46767-x

× close


A framework for DNA data storage systems with search capabilities and the general workflow of SEEKER. be The complete framework for a searchable DNA data storage system includes writing, searching, and reading data. b The oligo pool that stores text data is constructed in two parts: a reference strand and a data strand. The reference strand is typically composed of 100-200 oligos and can be used as a dictionary used to map the data strand to a binary code or pre-sequenced to determine the crRNA spacer sequence for the query of interest. can. For example, the keyword “courage” corresponds to the crRNA sequence “CTGTGCTAGCGTATGGCTCAT”. The data strands are selectively amplified according to the file ID and incubated with the Cas12a-crRNA ribonucleoprotein complex. If the amplified file contains many repetitions of the keyword “courage”, the fluorescence intensity will increase rapidly, producing a strong fluorescence signal within a short time. When fewer instances of the keyword “courage” appear in the file, the fluorescence enhancement is delayed and the endpoint fluorescence intensity becomes weaker. If the keyword “courage” is not found in the file, no fluorescence will be detected. After searching, files that generate a positive signal are recognized as containing the desired data and undergo next-generation sequencing to restore their full content. In this example, two occurrences of the keyword “courage” will generate a stronger signal, and one occurrence of the keyword “he” will generate a weaker signal. Illustration created by BioRender.com. credit: nature communications (2024). DOI: 10.1038/s41467-024-46767-x

The digital age has led to an explosion of data of all kinds. Traditional data storage methods such as hard drives are starting to face challenges due to limited storage capacity. As the demand for data storage increases, so does the popularity and need for alternative media for data storage.

DNA is one of the emerging solutions for storing data due to its physical density, data longevity, and data encryption capabilities. Any information that can be stored on a hard drive can also be converted into DNA sequences, including text, images, audio, and movies.

However, although DNA is a promising solution to meet data storage needs, performing searches within DNA strands can be cumbersome and difficult.

“Archiving information on synthetic DNA has emerged as an attractive solution to address the explosion of data in modern society. However, quantitatively querying data stored on DNA is It remains a challenge,” said Changchun Liu, professor in the Department of Biomedical Sciences. Engineering at UConn Health.

in nature communicationsLiu and a team of researchers used a quantitative search engine powered by clustered regularly interspaced short palindromic repeats (CRISPR) to easily and effectively search data stored in DNA. I found a way to search for it.

In his paper, Liu introduces Search Enablement through Enzymatic Keyword Recognition (SEEKER), which utilizes CRISPR-Cas12a to quantitatively identify keywords in files stored in DNA.

“DNA is a promising medium for data storage because of its stability and high information density. Theoretically, one gram of DNA can store 215 petabytes of data, which is approximately 100 million It’s the size of a movie. It’s like a hard drive that stores information in binary data.” DNA consists of four molecules: adenine (A), thymine (T), cytosine (C), and guanine (G). Stores information in sequences of nucleobases.

“With advances in DNA synthesis technology and next-generation sequencing, preservation of DNA data is becoming a reality,” explains Jiongyu Zhang, a graduate student in Liu’s lab and first author of the paper.

Liu leveraged his expertise in CRISPR technology to devise a better solution for searching within DNA strands.

CRISPR is an adaptive immune mechanism that can identify specific infectious DNA sequences in cells overwhelmed with interfering genes, similar to keyword searches in databases.

SEEKER utilizes CRISPR to rapidly generate visible fluorescence or light when a DNA target corresponding to the keyword of interest is present. SEEKER can successfully perform quantitative text searches because the rate of increase in fluorescence intensity is proportional to the keyword frequency.

In this paper, the researchers were able to identify keywords in 40 files against the backdrop of approximately 8,000 unrelated terms.

“Overall, SEEKER provides a quantitative approach to perform parallel searches, including metadata searches, against the complete content stored in DNA with easy implementation and rapid result generation,” said Liu. he explains.

For more information:
Jiongyu Zhang et al., Quantitative Keyword Search Engine Using CRISPR in DNA Data Storage; nature communications (2024). DOI: 10.1038/s41467-024-46767-x



Source link

Share. Facebook Twitter Pinterest LinkedIn Tumblr Email
Previous ArticleUbisoft lets you actually talk to NPCs in its new AI-powered video game
Next Article The majority of internet traffic is driven by APIs, and cybercriminals are taking advantage of them
5gantennas.org
  • Website

Related Posts

Crypto Markets Rise on Strong US Economic Data

August 29, 2024

Microsoft approves construction of third section of Mount Pleasant data center campus

August 29, 2024

China has invested $6.1 billion in state-run data center projects over two years, with the “East Data, West Computing” initiative aimed at capitalizing on the country’s untapped land.

August 29, 2024
Leave A Reply Cancel Reply

You must be logged in to post a comment.

Latest Posts

4 Best Wi-Fi Mesh Networking Systems in 2024

September 6, 2024

India is on the brink of a new revolution in telecommunications and can lead the world with 6G: Jyotiraditya Scindia

August 29, 2024

Speaker Pelosi slams California AI bill headed to Governor Newsom as ‘ignorant’

August 29, 2024

Crypto Markets Rise on Strong US Economic Data

August 29, 2024
Don't Miss

Business News | Communications Minister Scindia promotes 6G leadership and nationwide broadband in meeting with telecom operators

By 5gantennas.orgAugust 24, 2024

New Delhi [India]August 24 (ANI): Union Telecom Minister Jyotiraditya Scindia along with Minister of State…

SingTel and SK Telecom prepare for the 6G future

July 8, 2024

Apple focuses on 6G for future iPhones

December 11, 2023

Subscribe to Updates

Subscribe to our newsletter and never miss our latest news

Subscribe my Newsletter for New Posts & tips Let's stay updated!

About Us
About Us

Welcome to 5GAntennas.org, your reliable source for comprehensive information on 5G technology, artificial intelligence (AI), and data-related advancements. We are passionate about staying at the forefront of these cutting-edge fields and bringing you the latest insights, trends, and developments.

Facebook X (Twitter) Pinterest YouTube WhatsApp
Our Picks

4 Best Wi-Fi Mesh Networking Systems in 2024

September 6, 2024

India is on the brink of a new revolution in telecommunications and can lead the world with 6G: Jyotiraditya Scindia

August 29, 2024

Speaker Pelosi slams California AI bill headed to Governor Newsom as ‘ignorant’

August 29, 2024
Most Popular

Will 5G make 2024 the most connected year in the industry?

December 1, 2023

The current state of 5G in the US and how it can improve

September 28, 2023

How 5G technology will transform gaming on the go

January 31, 2024
© 2026 5gantennas. Designed by 5gantennas.
  • Home
  • About us
  • Contact us
  • DMCA
  • Privacy Policy
  • About Creator

Type above and press Enter to search. Press Esc to cancel.